Qual é o código genético e como funciona?

Qualquer que seja a diversidade morfológica que os seres vivos apresentam, estamos todos unidos sob o mesmo teto: nossa unidade funcional básica é a célula. Se um ser vivo tem uma célula sobre a qual repousa toda a sua estrutura morfológica, diz-se que é unicelular (caso dos protozoários ou bactérias), enquanto as que apresentamos várias (de algumas centenas a centenas de bilhões) somos seres multicelulares .

Assim, todo organismo deixa a célula e, portanto, algumas entidades moleculares, como os vírus, não são consideradas estritamente “vivas” do ponto de vista biológico. Por sua vez, os estudos caracterizaram que cada célula não contém nem mais nem menos do que 42 milhões de moléculas de proteína. Portanto, não é surpreendente que seja estimado que 50% do peso do tecido vivo seco seja composto apenas de proteína.

Por que estamos fornecendo todos esses dados aparentemente não relacionados? Hoje viemos desvendar o segredo da vida: o código genético. Por mais misterioso que possa parecer à primeira vista, garantimos que você compreenderá imediatamente este conceito. Células, proteínas e DNA são o que importa. Fique atento.

Qual é o código genético?

Vamos começar de uma forma clara e concisa: o código genético nada mais é do que o conjunto de instruções que dizem à célula como fazer uma proteína específica. Já dissemos nas linhas anteriores que as proteínas são a unidade estrutural essencial dos tecidos vivos, por isso não nos deparamos com uma questão anedótica: sem proteínas não há vida, tão simples.

As características do código genético foram estabelecidas em 1961 por Francis Crick, Sydney Brenner e outros biólogos moleculares colaboradores. Este termo é baseado em uma série de premissas, mas primeiro precisamos esclarecer alguns termos para entendê-los. Vamos a isto:

  • DNA: ácido nucléico contendo as instruções genéticas usadas no desenvolvimento e função de todos os organismos vivos existentes.
  • RNA: ácido nucléico que desempenha várias funções, incluindo direcionar as etapas intermediárias na síntese de proteínas.
  • Nucleotídeos: as moléculas orgânicas que, juntas, dão origem às cadeias de DNA e RNA de seres vivos.
  • Códon ou tripleto: todos os 3 aminoácidos formadores de RNA formam um códon, ou seja, um tripleto de informação genética.
  • Aminoácido: moléculas orgânicas que, em uma determinada ordem, dão origem às proteínas. 20 aminoácidos são codificados no código genético.

O básico do código genético

Assim que tivermos clareza sobre esses termos básicos, é hora de explorar as principais características do código genético, estabelecido por Crick e seus colegas. Estes são:

  • O código é organizado em tripletos ou códons: cada três nucleotídeos (códon ou tripleto) codifica um aminoácido.
  • O código genético é degenerado: há mais trigêmeos ou códons do que aminoácidos. Isso significa que um aminoácido é geralmente codificado por mais de um tripleto.
  • O código genético não se sobrepõe: um nucleotídeo pertence a apenas um tripleto. Em outras palavras, um nucleotídeo específico não está em dois códons ao mesmo tempo.
  • A leitura é “sem vírgula”: não queremos envolver uma terminologia muito complexa, então diremos que não há espaços entre os códons.
  • O código genético nuclear é universal: o mesmo trio em espécies diferentes codifica o mesmo aminoácido.

Desvendando o código genético

Já temos as bases terminológicas e os pilares teóricos. Agora é a hora de colocá-los em prática. Em primeiro lugar, vamos dizer-lhe que cada nucleotídeo recebe um nome baseado em uma letra, que é condicionado pela base nitrogenada que possui. As bases nitrogenadas são: adenina (A), citosina (C), guanina (G), timina (T) e uracila (U). Adenina, citosina e guanina são universais, enquanto a timina é exclusiva do DNA e o uracil é exclusivo do RNA. Se você vir isso, o que você acha que significa?:

CCT

CCU

Toque para recuperar os termos descritos acima. O CCT faz parte de uma fita de DNA, ou seja, 3 nucleotídeos diferentes: um com a base de citosina, outro com a base de citosina e outro com a base de timina. No segundo caso, em negrito, trata-se de um códon, pois se trata da informação genética do DNA “taducido” (de onde existe um uracilo onde antes havia uma. Timina) em uma fita de RNA.

Então podemos dizer que CCU é um códon que codifica o aminoácido prolina. Como dissemos antes, o código genético está degenerado. Assim, o aminoácido prolina também é codificado por outros códons com diferentes nucleotídeos: CCC, CCA, CCG. Então, o aminoácido prolina é codificado por um total de 4 códons ou tripletos.

Deve-se notar que nem todos os 4 códons são necessários para codificar o aminoácido, mas todos eles são válidos. Geralmente, aminoácidos essenciais são codificados por 2,3,4 ou 6 códons diferentes, com exceção da metionina e do triptofano que respondem apenas um cada.

Por que tanta complexidade?

Fazemos cálculos. Se cada códon fosse codificado por um único nucleotídeo, apenas 4 aminoácidos diferentes poderiam ser formados. Isso tornaria a síntese de proteínas um processo impossível, já que geralmente cada proteína é composta por cerca de 100 a 300 aminoácidos. Existem apenas 20 aminoácidos incluídos no código genéticoMas eles podem ser classificados de diferentes maneiras ao longo da “linha de montagem” para dar origem às diferentes proteínas presentes em nossos tecidos.

Por outro lado, se cada códon consistisse em dois nucleotídeos, o número total de “graduados” possíveis seria 16. Ainda estamos longe da meta. No entanto, se cada códon consistisse em três nucleotídeos (como é), o número de permutações possíveis aumentaria para 64. Como existem 20 aminoácidos essenciais, com 64 códons, é possível codificar cada um deles e, além disso, para isso, ofereça variações diferentes em cada caso.

Um visual aplicado

Estamos ficando sem espaço, mas é muito complexo colocar tanta informação em poucas linhas. Siga o diagrama a seguir, pois prometemos a você que encerrar todo esse conglomerado de terminologia é muito mais fácil do que parece:

CCT (DNA) → CCU (RNA) → Prolina (ribossomo)

Este pequeno diagrama nos diz o seguinte: o DNA celular contém os 3 nucleotídeos do CCT, mas não pode “expressar” a informação genética, pois está isolado da maquinaria celular no núcleo do mesmo.. Portanto, a enzima RNA polimerase é responsável pela transcrição (processo conhecido como transcrição) de nucleotídeos de DNA em nucleotídeos de RNA, que formarão o RNA mensageiro.

Agora temos o códon CCU no RNA mensageiro, que viajará para fora do núcleo através de seus poros até o citosol, onde os ribossomos estão localizados. Em suma, podemos dizer que o RNA mensageiro fornece essa informação ao ribossomo, Que “entende” que deve adicionar o aminoácido prolina à sequência de aminoácidos já construída para dar origem a uma determinada proteína.

Como dissemos acima, uma proteína é composta por cerca de 100 a 300 aminoácidos. Assim, qualquer proteína formada a partir do arranjo de 300 aminoácidos, será codificada por um total de 900 tripletos (300×3) ou, se preferir, por 2700 nucleotídeos (300x3x3). Agora imagine cada uma das letras de cada um dos 2700 nucleotídeos, algo como: AAAUCCCCGGUGAUUUAUAAGG (…) É esse arranjo, esse conglomerado de letras, que é realmente o código genético. Mais fácil do que parecia à primeira vista, certo?

resumo

Se você perguntar a um biólogo interessado em biologia molecular sobre o código genético, provavelmente terá uma conversa de 4 a 5 horas. É verdadeiramente fascinante saber que o segredo da vida, por mais irreal que possa parecer, está encerrado em uma sucessão específica de “letras”.

Portanto, o genoma de todas as coisas vivas pode ser mapeado com essas 4 letras. Por exemplo, de acordo com o Projeto Genoma Humano, toda a informação genética da nossa espécie é composta por 3 bilhões de pares de bases (nucleotídeos), que se encontram nos 23 pares de cromossomos do núcleo de todas as nossas células. Claro, por mais diferentes que sejamos como seres vivos, todos apresentamos uma “linguagem” comum.

Referências bibliográficas:

  • Qual é o código genético? genotipia.com. Obtido em: https://genotipia.com/codigo-genetico/
  • Asimov, I. e de la Font, AM (1982). O código genético (Sirsi no. I9789688561034). Plaza e Janés.
  • Código genético, Instituto Nacional de Pesquisa do Genoma Humano. Obtido em: https://www.genome.gov/es/genetics-glossary/Codigo-genetico
  • Código genético: características e descriptografia, Universidade Complutense de Madrid (UCM). Obtido em: https://www.ucm.es/data/cont/media/www/pag-56185/08-C%C3%B3digo%20Gen%C3%A9tico-caracter%C3%ADsticas%20y%20desciframiento.pdf
  • O código genético, Khanacademy.org. Obtido em: https://es.khanacademy.org/science/ap-biology/gene-expression-and-regulation/translation/a/the-genetic-code-discovery-and-properties
  • É oficial: existem 42 milhões de moléculas de proteína em cada célula, europapress.com. Obtido em: https://www.europapress.es/ciencia/laboratorio/noticia-oficial-hay-42-millones-moleculas-proteina-cada-celula-20180117181506.html
  • Lee, TF (1994). The Human Genome Project: Breaking the Genetic Code of Life (No. Sirsi) i9788474325072).

Deixe um comentário